In his latest post, Rana asserts the following about the argument for common ancestry from pseudogenes:
When evolutionary biologists present this argument, they make a number of assumptions, all of which appear to have questionable validity based on recent research results. For the pseudogene evidence to have potency: (1) pseudogenes must lack function; (2) their origin must be due to rare, random events; and (3) their juxtaposition to other genes must be arbitrary.Everything he wrote there is utterly false. None of those conditions are required to argue for common ancestry from pseudogene similarity. Not one.
Here's a simple example. Consider these two pairs of sequences:
ACTCTTCTGGTCCCCACAGACTCAGAAAGAACCCACCATGGTGCTGTCTCCTGCCGACAA
ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAA
They are identical except for the nucleotides in bold face (that's one difference out of 60, which makes the sequences 98.3% identical). Now consider these two sequences:
GCATGGACTAAGCTAAGCTGCTACCATTCATCGAAGTGTGCTAACTCCACTGAGTGAAGT
GCATGGACTAAGCTAAGCTGCTACCACTCATCGAAGTGTGCTAACTCCACTGAGTGAAGT
They also differ by a single nucleotide out of 60 (also 98.3% identical). Both pairs of sequences are so similar that they could not possibly be similar due to chance. The simplest explanation is that they were copied imperfectly from a common source.
Now here's the trick: One of those sequence pairs is the real nucleotide sequence of the chimpanzee alpha globin mRNA aligned to the real nucleotide sequence of the human alpha globin mRNA. The other sequence pair consists of a sequence that I just made up, then copied and altered one nucleotide. So one of the sequence pairs is functional and important, and one is just gibberish. Does knowing that change the argument that they came from a common source? Not one bit.
How do we go from a common source to a common ancestor? It's the pattern of similarities, not the similarity itself. I've blogged extensively about this before:
Owen's Archetype
What about transitional forms?
Notch revisited
I've even mentioned it in an earlier critique of Fuz Rana, Neandertal non-sequitur, where I wrote:
The fact of similarity is easy to account for. Being created by one God would be a good reason for some degree of similarity to exist. Likewise, being created to occupy the same world or to participate in the same ecosystem would also necessitate some biological similarity. These types of considerations could explain why all living things use the same basic biochemical building blocks (amino acids, nucleotides, etc.), for example. What these considerations do not explain is the pattern of similarity. This is quite a different problem that is easy to confuse with the fact of similarity. What we're dealing with in creation is not just bare similarity or random similarity. There is a definite pattern, and it's a pattern that Darwin says is uniquely explained by the inference of common ancestry.
The assumed non-functionality of pseudogenes is what gets them singled out as a particularly interesting example of an argument for common ancestry, for the reasons that Venema explained in his post. Here's another perspective on the problem from one of my posts on rudimentary structures:
A more subtle mistake is the insistence that vestigial organs have no function, that they are true evolutionary leftovers that are just waiting to be eliminated from our bodies. This leads to the equally fallacious response that by demonstrating a function - any function - the vestigial argument is nullified. In response to this reasoning, Steve Matheson made a great analogy to the function of a 1989 Yugo: Just because you can turn a Yugo into something useful, like a mailbox or port-a-potty, doesn't make it any less a vestigial car. In fact, it makes its car-ness all the stranger, since its automotive attributes have nothing to do with its function as a mailbox or whatnot.
There's only one more point I want to make about Rana's latest post. After completely misunderstanding the argument for common ancestry, Rana wrote,
In fact, two of the articles on our website discuss papers (published in peer-reviewed journals) that emphasize how widespread pseudogene function actually is. Researchers have discovered that the genesis of certain classes of junk DNA is not rare and random, but occurs frequently and in a repeatable manner. (Go here and here to read recent articles.)Notice how oddly disjointed that is. First, he says that there are two articles supporting "widespread pseudogene function," then he shifts to an unrelated statement about "junk DNA" before referring us to those articles on pseudogene function that he mentioned. Except that neither article is about pseudogene function. The first is about introns, and the second is about transposable elements. Where are the two articles that support "widespread pseudogene function?" I have no idea. He doesn't actually link to them.
So that's enough for today. Tomorrow, this series ends one way or another.
Feedback? Email me at toddcharleswood [at] gmail [dot] com.